Skip to Content
Merck
All Photos(1)

Documents

EHU022331

Sigma-Aldrich

MISSION® esiRNA

targeting human EDN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Hao et al.
Diabetes, metabolic syndrome and obesity : targets and therapy, 14, 1405-1418 (2021-04-02)
Mesenchymal stem cell (MSC)-derived exosomes have seen great advances in human disease control in a minimally invasive manner. This research aimed to explore the function of MSC-derived exosomes in diabetic nephropathy (DN) progression and the molecules involved. A rat model
Xianwei Wang et al.
Journal of molecular and cellular cardiology, 80, 101-109 (2015-01-15)
Endothelin-1 (ET-1) plays a major role in regulating myocardial fibrosis in several pathological conditions, such as hypertension and diabetes. Aging is an independent risk factor for myocardial fibrosis. We hypothesized that ET-1 upregulation may be a basis of enhanced collagen
Shannon N Acker et al.
Pediatric research, 77(4), 511-519 (2015-01-13)
Pulmonary hypertension (PH) secondary to vascular remodeling contributes to poor outcomes in congenital diaphragmatic hernia (CDH), however mechanisms responsible are unknown. We hypothesized that pulmonary artery endothelial cell (PAEC) dysfunction contributes to smooth muscle cell (SMC) hyperplasia in experimental CDH.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service