Skip to Content
Merck
All Photos(1)

Documents

EHU017161

Sigma-Aldrich

MISSION® esiRNA

targeting human PPP3CA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACAGTTCCTGTGTGTGCATGGTGGTTTGTCTCCAGAGATTAACACTTTAGATGATATCAGAAAATTAGACCGATTCAAAGAACCACCTGCATATGGACCTATGTGTGATATCCTGTGGTCAGACCCCCTGGAAGATTTTGGAAATGAGAAGACTCAGGAACATTTCACTCACAACACAGTCAGGGGGTGTTCATACTTCTACAGTTACCCGGCTGTATGTGAATTCTTACAGCACAATAACTTGTTATCTATACTCCGAGCCCACGAAGCCCAAGATGCAGGGTACCGCATGTACAGGAAAAGCCAAACAACAGGCTTCCCTTCTCTAATTACAATTTTTTCAGCACCAAATTACTTAGATGTATACAATAACAAAGCTGCAGTATTGAAGTATGAGAACAATGTTATGAATATCAGGCAATTCAACTGTTCTCCTCATCCATACTGGCTTCCAAATTTCATGGATGTTTTTACTTGGTCCCTTCCATTTGTTGGGGAAAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junfen Xu et al.
Molecular therapy. Nucleic acids, 22, 1176-1190 (2020-12-15)
Circular RNAs (circRNAs) function as efficient microRNA (miRNA) sponges that regulate gene expression in the pathogenesis of many human malignancies. However, their roles in cervical adenocarcinoma remain largely unknown. In this study, we aimed to seek novel circRNAs that regulate
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service