Skip to Content
Merck
All Photos(1)

Documents

EHU003471

Sigma-Aldrich

MISSION® esiRNA

targeting human SRF

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Ensembl | human accession no.

ENSG00000112658

NCBI accession no.

NM_003131

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SRF(6722) , SRF(6722)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xi He et al.
Oncology letters, 5(3), 819-824 (2013-02-22)
Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry
Qi Li et al.
PloS one, 8(9), e75470-e75470 (2013-09-24)
Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct
Carolina Leimgruber et al.
Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)
Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures
Min-Seok Kim et al.
Scientific reports, 9(1), 4631-4631 (2019-03-16)
Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically
Friederike Flachsbart et al.
Nature communications, 8(1), 2063-2063 (2017-12-14)
FOXO3 is consistently annotated as a human longevity gene. However, functional variants and underlying mechanisms for the association remain unknown. Here, we perform resequencing of the FOXO3 locus and single-nucleotide variant (SNV) genotyping in three European populations. We find two
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service