form
lyophilized
lyophilized powder
esiRNA cDNA target sequence
AAGTGGCAGCATGACCTGTTCATTGGAGGCTTCAGGGGTCAAAACCACGTGGATACTGGTGGGAAGCTCTTCTTGTCAAATCTGCACTTCGGAGTGTCAGATGCTGATATTCAGCTACTCTTTGCTGAATTTGGAACGTTGAAGAAATCTGCTGTGCACT
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... GM6763(100043292)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
11 - Combustible Solids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service