Skip to Content
Merck
All Photos(1)

Key Documents

EMU095351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stmn1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on03 April 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on03 April 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCACAAAATGGAGGCTAACAAAGAGAACCGGGAGGCGCAGATGGCGGCCAAGCTGGAGCGCTTGCGAGAGAAGGACAAGCACGTGGAAGAGGTGCGGAAGAACAAAGAATCCAAAGACCCCGCGGATGAGACTGAGGCTGACTAAGTTGTCCCGAGAACTGACTTTCTCCCCGACCCCGTCCTAAATATCCAAAGACTGTACTGGCCAGTGTCCTTTACTTTCCCTCCTGACAGATAGTCTAGAAGCCGATGTAGGACCGTATAGGTAGATCCAGACCGTGAGATGTTTTAGGGGCTCAAGGGGAGAAACTGAAAGTGTTTTACTCTTTTTTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTCGTTGCATCTTTTCCACTCGGGCACAATCGGTGTGCTGGGTTAATGGCTAGTACTGTATTGACTGTGGAAGACGTTTGTGAAGAGTATGTAGTGGCTTCTTCCAACCCATTAGATGCTGAATATCTGTCCACTTTGCGATCCCAATTCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

W Feng et al.
Cancer gene therapy, 22(3), 115-121 (2015-01-13)
Paclitaxel (PTX) is broadly considered the drug of choice for treating human esophageal squamous cell cancer (ESCC). However, PTX resistance often ultimately leads to treatment failure. stathmin, or Op18, is a ubiquitously expressed 19-kDa cytosolic phosphoprotein that can integrate various
Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
Kimberly A Birnie et al.
Molecular cancer research : MCR, 13(7), 1106-1118 (2015-04-01)
Malignant pleural mesothelioma (MPM) is often fatal, and studies have revealed that aberrant miRNAs contribute to MPM development and aggressiveness. Here, a screen of miRNAs identified reduced levels of miR-223 in MPM patient specimens. Interestingly, miR-223 targets Stathmin (STMN1), a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service