Skip to Content
Merck
All Photos(1)

Key Documents

EMU074311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fermt2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAACTTTAAAGCTATTGTTTCTTATATGCTGCTTAATAAAGTAAGCTTGAACTTTATTATTTTATCATGATACCTTTTTGCCTTACCAGACCAGTACATATGTGCACTAACAAGCACGATTGTTAATCTGCTGCCTACCTTGATATGCCGTATGTGGACTGTGGAATTCCCAACAGTCCTTAGGGCCACGGAAAGCTGTCACTGACTGACAGTAACCAAACTAAGAAACAAGCCATCTACCAAGCCAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Yu et al.
PloS one, 8(5), e63490-e63490 (2013-05-30)
Kindlin 2, as an integrin-associated protein, is required for myocyte elongation and fusion. However, the association of Kindlin 2 with muscle differentiation-related signaling pathways is unknown. Here, we identified a mechanism that Kindlin 2 regulates myogenic regulatory factors myogenin via
Hai-Feng Zhang et al.
Oncotarget, 6(30), 28949-28960 (2015-09-04)
Our previous studies have shown that loss of miR-200b enhances the invasiveness of esophageal squamous cell carcinoma (ESCC) cells. However, whether the miR-200-ZEB1/2-E-cadherin regulatory cascade, a master regulator of epithelial-to-mesenchymal transition (EMT), is involved in the regulation of ESCC invasion
Zhaoli Liu et al.
FEBS letters, 589(15), 2001-2010 (2015-06-04)
Kindlin-2 regulates external to internal cell signaling by interaction with integrins in a process that involves the tyrosine kinase, Src. However, the underlying mechanisms remain elusive. Here we report that Src binds to and phosphorylates Kindlin-2 at Y193. Reciprocally, Kindlin-2-Y193

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service