Skip to Content
Merck
All Photos(1)

Documents

EMU061231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAGTTCTGCCAGCTTGGTGTCATCACAAGCTAGTTCCAGCTCCTTTTTCACCAATGCCAATAGTTATTCAACAACTACTACCACCAGCAACATGGGAATTATGAACTTTACCAGCAGTGGTTCATCAGGGACTAGTTCTCAAGGCCAGACGCCCCAGAGGGTTGGTGGGCTACAAGGGTCTGATTCTCTGAACATCCAGCAGAACCAGACATCAGGAGGCTCGCTGCAAGGAAGTCAGCAGAAAGAGGGAGAGCAAAGTCAGCAGACACAGCAACAACAAATTCTTATTCAGCCTCAGCTAGTTCAAGGAGGACAAGCTCTTCAGGCCCTTCAAGCAGCACCATTGTCCGGACAGACCTTCACAACTCAAGCTATTTCCCAGGAAACCCTTCAGAACCTCC

Ensembl | mouse accession no.

ENSMUSG00000001280

NCBI accession no.

NM_013672

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SP1(20683) , Sp1(20683)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kazuo Asanoma et al.
Molecular and cellular biology, 35(24), 4096-4109 (2015-09-24)
BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
Li Yan et al.
American journal of cancer research, 5(4), 1447-1459 (2015-06-24)
Recent evidence suggests that miR-520 family has an important role in regulating tumorigenesis and development of various types of solid cancers. However, as one of the most common cancers in the world, there is little known about the underlying regulatory
Dong-Qin Chen et al.
Oncotarget, 5(10), 3333-3349 (2014-05-17)
Chemoresistance is one of the most significant obstacles in lung adenocarcinoma (LAD) treatment, and this process involves genetic and epigenetic dysregulation of chemoresistance-related genes. Previously, we have shown that restoration of microRNA (miR)-200b significantly reverses chemoresistance of human LAD cells
Pablo Secades et al.
Head & neck, 37(8), 1150-1162 (2014-05-07)
We previously showed that activation of epidermal growth factor receptor (EGFR) induces hypoxia inducible factor-1α (HIF-1α) in head and neck squamous cell carcinoma (HNSCC) cells. In this study, we have furthered this by investigating the mechanism of HIF-1α activation by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service