Skip to Content
Merck
All Photos(1)

Documents

EMU023861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nampt

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCGACTCGTACAAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGGAAGGTGAAATACGAGGAAACAGTATTTTATGGGTTGCAGTACATTCTTAATAAGTACTTAAAAGGTAAAGTAGTGACCAAAGAGAAAATCCAGGAGGCCAAAGAAGTGTACAGAGAACATTTCCAAGATGATGTCTTTAACGAAAGAGGATGGAACTACATCCTTGAGAAATACGATGGTCATCTCCCGATTGAAGTAAAGGCTGTTCCCGAGGGCTCTGTCATCCCCAGAGGGAACGTGCTGTTCACAGTGGAAAACACAGACCCAGAGTGCTACTGGCTTACCAATTGGATTGAGACTATTCTTGTTCAGTCCTGGTATCCAATTACAGTGGCCACAA

Ensembl | mouse accession no.

ENSMUSG00000020572

NCBI accession no.

NM_021524

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... NAMPT(59027) , Nampt(59027)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xu He et al.
Experimental cell research, 352(1), 45-52 (2017-02-06)
Decreased bone volume and strength with aging and enhanced risk of fractures are in part due to reduced number of bone-forming mesenchymal stem cells (MSCs) and cellular dysfunction. In a previous study, we found that osteogenic differentiation of the multipotent
Min Ling et al.
Cell & bioscience, 7, 27-27 (2017-05-27)
Bone degenerative disorders like osteoporosis may be initiated by age-related shifts in anabolic and catabolic responses that control bone homeostasis. Although there are studies suggesting that metabolic changes occur with stem cell differentiation, the molecular mechanisms governing energy metabolism and
Xia Wang et al.
Scientific reports, 5, 12657-12657 (2015-08-01)
Nicotinamide phosphoribosyltransferase (NAMPT) is a promising antitumor target. Novel NAMPT inhibitors with diverse chemotypes are highly desirable for development of antitumor agents. Using high throughput screening system targeting NAMPT on a chemical library of 30000 small-molecules, we found a non-fluorescent
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service