Skip to Content
Merck
All Photos(1)

Key Documents

EHU153581

Sigma-Aldrich

MISSION® esiRNA

targeting human TESC

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on12 May 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on12 May 2025Details


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTACCATTCGCAAGGAGAACTTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAACAGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTAAAGTGGTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jieun Kang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13843-13853 (2016-08-04)
We reported previously that tescalcin (TESC) levels were higher in tissue and serum from colorectal cancer (CRC) patients and suggested that TESC was a potential oncotarget in CRC. The aim of this study was to investigate the function of TESC
Ai-Jing Luo et al.
Experimental and molecular pathology, 107, 110-117 (2018-12-31)
Renal cell carcinoma (RCC) is the most common form of kidney cancer. Recent studies reported that Tescalcin was overexpressed in various tumor types. However, the status of Tescalcin protein expression in RCC and its biological function is uncertain. This study
Yun Hee Kang et al.
Oncotarget, 5(8), 2149-2160 (2014-05-09)
Tescalcin (TESC) is an EF-hand calcium binding protein that is differentially expressed in several tissues, however it is not reported that the expression and functional roles of TESC in colorectal cancer. Levels of messenger RNA (mRNA) and protein expression of

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service