Skip to Content
Merck
All Photos(1)

Documents

EHU150631

Sigma-Aldrich

MISSION® esiRNA

targeting human ADIPOQ, ADIPOQ-AS1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGATCACCACTAACTCAGAGCCTCCTCCAGGCCAAACAGCCCCAAAGTCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Roberta G Marangoni et al.
Scientific reports, 7(1), 4397-4397 (2017-07-02)
Skin fibrosis in systemic sclerosis (SSc) is accompanied by attrition of dermal white adipose tissue (dWAT) and reduced levels of circulating adiponectin. Since adiponectin has potent regulatory effects on fibroblasts, we sought to assess adiponectin signaling in SSc skin biopsies
Juhyun Song et al.
Cell death & disease, 8(10), e3102-e3102 (2017-10-13)
Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by excessive beta amyloid (Aβ) deposition in brain, leading to blood-brain barrier (BBB) disruption. The mechanisms of BBB disruption in AD are still unclear, despite considerable research. The adipokine adiponectin
Yuu Okura et al.
International journal of molecular sciences, 20(7) (2019-04-03)
Both adiponectin and secreted protein, acidic and rich in cysteine (SPARC) inhibit platelet-derived growth factor-BB (PDGF-BB)-induced and basic fibroblast growth factor (FGF2)-induced angiogenic activities through direct and indirect interactions. Although SPARC enhances nerve growth factor (NGF)-dependent neurogenesis, the physical interaction
H-Q Tang et al.
European review for medical and pharmacological sciences, 24(14), 7645-7654 (2020-08-04)
To investigate the expression of Long non-coding RNA ADIPOQ and its facilitating effects on proliferation and invasion of colorectal cancer by modulating the expression of TP53 via sponging with miR-219c-3p. qRT-PCR was performed to detect the expressions of ADIPOQ and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service