Skip to Content
Merck
All Photos(1)

Key Documents

EHU147141

Sigma-Aldrich

MISSION® esiRNA

targeting human HIST1H1B

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on19 May 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on19 May 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATCCCCGGCTAAGAAGAAGGCAACTAAGAAGGCTGCCGGCGCCGGCGCTGCTAAGCGCAAAGCGACGGGGCCCCCAGTCTCAGAGCTGATCACCAAGGCTGTGGCTGCTTCTAAGGAGCGCAATGGCCTTTCTTTGGCAGCCCTTAAGAAGGCCTTAGCGGCCGGTGGCTACGACGTGGAGAAGAATAACAGCCGCATTAAGCTGGGCCTCAAGAGCTTGGTGAGCAAGGGCACCCTGGTGCAGACCAAGGGCACTGGTGCTTCTGGCTCCTTTAAACTCAACAAGAAGGCGGCCTCCGGGGAAGCCAAGCCCAAAGCCAAGAAGGCAGGCGCCGCTAAAGCTAAGAAGCCCGCGGGGGCCACGCCTAAGAAGGCCAAGAAGGCTGCAGGGGCGAAAAAGGCAGTGAAGAAGACTCCGAAGAAGGCGAAGAAGCCCGCGGCGGCTGGCGTCAAAAAGGTGGCGAAGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ohad Glaich et al.
Nucleic acids research, 47(12), 6145-6159 (2019-05-12)
Chromatin organization and epigenetic markers influence splicing, though the magnitudes of these effects and the mechanisms are largely unknown. Here, we demonstrate that linker histone H1.5 influences mRNA splicing. We observed that linker histone H1.5 binds DNA over splice sites
Wei Guo et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 9049-9057 (2015-06-19)
A recent study reported that miR-570 was the most important microRNA in the microRNA gene networks of alcoholic liver disease that has the potential of progressing to hepatocellular carcinoma. However, litter is known regarding the expression and specific function of

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service