Skip to Content
Merck
All Photos(1)

Key Documents

EHU122041

Sigma-Aldrich

MISSION® esiRNA

targeting human MCAM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACGGCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Connor Stevenson et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(8), 691-700 (2017-04-30)
To evaluate the effects of MUC18 on IL-13-mediated airway inflammatory responses in human airway epithelial cells and in mice. Primary normal human tracheobronchial epithelial (HTBE) cells, wild-type (WT) and Muc18 knockout (KO) mice, and mouse tracheal epithelial cells (mTECs) were
Toshio Yawata et al.
Journal of neuro-oncology, 144(1), 21-32 (2019-05-31)
CD146 is highly expressed in various malignant tumors and contributes to their malignancy phenotype, which involves metastatic and tumorigenic activity. However, studies on the expression and function of CD146 in brain tumors are limited. We over-expressed or knocked-down CD146 in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service