Skip to Content
Merck
All Photos(1)

Key Documents

EHU104281

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTCAACGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCCCTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATCACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCCCAGCAGGAGGCCCAGCGGGCCCAATTCTTGGTAGAAAAAGCAAAGCAGGAACAGCGGCAGAAAATTGTGCAGGCCGAGGGTGAGGCCGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAACCCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAGAATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGTACAGTGACAGCCTCATCAAGGGT

Ensembl | human accession no.

ENSG00000215021

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PHB2(11331) , PHB2(11331)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tongyu Zhang et al.
Stroke, 50(4), 978-988 (2019-03-21)
Background and Purpose- Mitoquinone has been reported as a mitochondria-targeting antioxidant to promote mitophagy in various chronic diseases. Here, our aim was to study the role of mitoquinone in mitophagy activation and oxidative stress-induced neuronal death reduction after subarachnoid hemorrhage
Heng-Hsiung Wu et al.
Journal of food and drug analysis, 28(1), 183-194 (2019-12-31)
Membranous nephropathy (MN) is the most common cause of nephrotic syndrome in adults, when not effectively treated. The aim of this study was to discover new targets for the diagnosis and treatment of MN. A reliable mouse model of MN
Ting Huang et al.
Frontiers in immunology, 11, 569173-569173 (2020-10-30)
Mitophagy has recently been implicated in bacterial infection but the underlying mechanism remains largely unknown. Here, we uncover a role of microRNA-302/367 cluster in regulating mitophagy and its associated host response against bacterial infection. We demonstrate that miR-302/367 cluster expression
Cristina Moncunill-Massaguer et al.
Oncotarget, 6(39), 41750-41765 (2015-10-27)
We previously described diaryl trifluorothiazoline compound 1a (hereafter referred to as fluorizoline) as a first-in-class small molecule that induces p53-independent apoptosis in a wide range of tumor cell lines. Fluorizoline directly binds to prohibitin 1 and 2 (PHBs), two proteins

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service