Skip to Content
Merck
All Photos(1)

Key Documents

EHU092661

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT8

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on28 April 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on28 April 2025Details


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCTGCAAACTTCCATTCTTTAGATGACATCTACTATTTTGGGGGCCAGAATGCCCACAATCAAATTGCCATTTATGCTCACCAACCCCGAACTGCAGATGAAATTCCCATGGAACCTGGAGATATCATTGGTGTGGCTGGAAATCATTGGGATGGCTATTCTAAAGGTGTCAACAGGAAATTGGGAAGGACGGGCCTATATCCCTCCTACAAAGTTCGAGAGAAGATAGAAACGGTCAAGTACCCCACATATCCTGAGGCTGAGAAATAAAGCTCAGATGGAAGAGATAAACGACCAAACTCAGTTCGACCAAACTCAGTTCAAACCATTTCAGCCAAACTGTAGATGAAGAGGGCTCTGATCTAACAAAATAAGGTTATATGAGTAGATACTCTCAGCACCAAGAGCAGCTGGGAACTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Yu et al.
Placenta, 75, 45-53 (2019-02-05)
Trophoblast proliferation and invasion are essential for embryo implantation and placentation. Protein glycosylation is one of the most common and vital post-translational modifications, regulates protein physical and biochemical properties. FUT8 is the only known fucosyltransferase responsible for catalyzing α1,6-fucosylation in
Shu Li et al.
Viruses, 11(4) (2019-04-27)
Hepatitis C virus (HCV) is a major cause of human chronic liver disease and hepatocellular carcinoma. Our recent studies showed that α1,6-fucosyltransferase (FUT8), a key glycosyltransferase, was the most up-regulated glycosyltransferase after the HCV infection of human hepatocellular carcinoma Huh7.5.1
Kazuhiro Tada et al.
Surgery today, 50(7), 767-777 (2020-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. It is an aggressive malignancy associated with poor prognosis because of recurrence, metastasis, and treatment resistance. Aberrant glycosylation of cancer cells triggers their migration and invasion and is
Li Shen et al.
Cellular oncology (Dordrecht), 43(4), 695-707 (2020-06-01)
Radio-resistance is recognized as a main factor in the failure of radiotherapy in oesophageal squamous cell carcinoma (ESCC). Aberrant cell surface glycosylation has been reported to correlate with radio-resistance in different kinds of tumours. However, glycomic alterations and the corresponding
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service