Skip to Content
Merck
All Photos(1)

Key Documents

EHU078761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on21 April 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on21 April 2025Details


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCTGGAGTCCTACATCTCACAGCAGAAGACGGGCGTGGGAGGGACTGGAATTGACATCCCTGTCCTGCTCCTCCTGATTGATGGTGATGAGAAGATGTTGACGCGAATAGAGAACGCCACCCAGGCTCAGCTCCCATGTCTCCTCGTGGCTGGCTCAGGGGGAGCTGCGGACTGCCTGGCGGAGACCCTGGAAGACACTCTGGCCCCAGGGAGTGGGGGAGCCAGGCAAGGCGAAGCCCGAGATCGAATCAGGCGTTTCTTTCCCAAAGGGGACCTTGAGGTCCTGCAGGCCCAGGTGGAGAGGATTATGACCCGGAAGGAGCTCCTGACAGTCTATTCTTCTGAGGATGGGTCTGAGGAATTCGAGACCATAGTTTTGAAGGCCCTTGTGAAGGCCTGTGGGAGCTCGGAGGCCTCAGCCTACCTGGATGAGCTGCGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xi Hong et al.
American journal of physiology. Cell physiology, 316(4), C463-C480 (2018-12-20)
Prostate cancer (PCa) remains one of the leading causes of cancer-related deaths among males. The aim of the current study was to investigate the ability of microRNA-150 (miR-150) targeting transient receptor potential melastatin 4 (TRPM4) to mediate epithelial-mesenchymal transition (EMT)
Fujue Wang et al.
Cellular signalling, 72, 109643-109643 (2020-04-23)
Transient Receptor Potential Melastatin Subfamily Member 4 (TRPM4) has been demonstrated to be aberrantly expressed in several cancers but seldom reported in acute leukemia. Based on database mining and validated experiments, our present data show that TRPM4 is selectively overexpressed
Elías Leiva-Salcedo et al.
Channels (Austin, Tex.), 11(6), 624-635 (2017-09-07)
Cerebral ischemia-reperfusion injury triggers a deleterious process ending in neuronal death. This process has two components, a glutamate-dependent and a glutamate-independent mechanism. In the glutamate-independent mechanism, neurons undergo a slow depolarization eventually leading to neuronal death. However, little is known
Chun-Xiao Yu et al.
Toxicology letters, 312, 98-108 (2019-05-06)
To investigate the effect of Arsenic Trioxide (ATO) on endothelial cells injury and explore the role of transient receptor potential melastatin 4 channel (TRPM4) in ATO-induced endothelial injury. qRT-PCR was used to examine the mRNA expression of TRPM4 in human
Christian Holzmann et al.
Oncotarget, 6(39), 41783-41793 (2015-10-27)
Impaired Ca2+ signaling in prostate cancer contributes to several cancer hallmarks, such as enhanced proliferation and migration and a decreased ability to induce apoptosis. Na+ influx via transient receptor potential melastatin 4 channel (TRPM4) can reduce store-operated Ca2+ entry (SOCE)

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service