Skip to Content
Merck
All Photos(1)

Documents

EHU071641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hiroki Satooka et al.
Molecular and cellular biology, 36(7), 1206-1218 (2016-02-03)
Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Mariko Hara-Chikuma et al.
Biochemical and biophysical research communications, 471(4), 603-609 (2016-02-21)
Aquaporin 3 (AQP3), a water/glycerol channel protein, is capable of transporting hydrogen peroxide (H2O2). Here, we show that AQP3-mediated intracellular H2O2 is involved in epidermal growth factor (EGF)-induced cell signaling and its dependent cell function in the EGF receptor (EGFR)-positive
Ayah E Ahmad et al.
International journal of oncology, 56(4), 1014-1024 (2020-04-23)
Estrogen receptor (ER)‑silenced breast cancer cell lines exhibit endocrine resistance and morphological changes from an epithelial to a mesenchymal phenotype. These cells also display increased motility and invasive properties that are further accentuated by exposure to an alkaline pH, exhibiting
Ya-Jing Tan et al.
Scientific reports, 5, 17741-17741 (2015-12-05)
Hyperosmotic stress may induce apoptosis of different cells. However, oocytes show tolerance to osmotic stress during cryopreservation by vitrification, which is an assisted reproductive technique. The underlying mechanism is still not understood. Here, we demonstrated that hyperosmosis produced by high

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service