Skip to Content
Merck
All Photos(1)

Key Documents

EHU059511

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on12 March 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on12 March 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTCATGGAGAGCAGCTTCCAAATCACAGAGGAGACCCAGATTGACACCACCCTGCGGCGCAGCCAGATGTCCCCCCAAGGCCTGCGGGTCCGTCTGCGGCCCGGTGAGGAGCGGCATTTTGAGCTGGAGGTGTTTGAGCCACTGGAGAGCCCCGTGGACCTGTACATCCTCATGGACTTCTCCAACTCCATGTCCGATGATCTGGACAACCTCAAGAAGATGGGGCAGAACCTGGCTCGGGTCCTGAGCCAGCTCACCAGCGACTACACTATTGGATTTGGCAAGTTTGTGGACAAAGTCAGCGTCCCGCAGACGGACATGAGGCCTGAGAAGCTGAAGGAGCCCTGGCCCAACAGTGACCCCCCCTTCTCCTTCAAGAACGTCATCAGCCTGACAGAAGATGTGGATGAGTTCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiangli Meng et al.
Bosnian journal of basic medical sciences, 20(1), 106-116 (2019-06-27)
Pancreatic cancer is the fourth leading cause of cancer death, with a 5-year survival rate of only 1-4%. Integrin-mediated cell adhesion is critical for the initiation, progression, and metastasis of cancer. In this study we investigated the role of integrin
Jin Sol Sung et al.
Oncogene, 39(3), 664-676 (2019-09-20)
Integrin beta 4 (ITGB4) overexpression in cancer cells contributes to cancer progression. However, the role of stromal ITGB4 expression in cancer progression remains poorly understood, despite stromal ITGB4 overexpression in malignant cancers. In our study, ITGB4-overexpressing triple negative breast cancer
Rachel Evans et al.
Cell reports, 27(7), 1967-1978 (2019-05-16)
Lymphatic vasculature is crucial for metastasis in triple-negative breast cancer (TNBC); however, cellular and molecular drivers controlling lymphovascular metastasis are poorly understood. We define a macrophage-dependent signaling cascade that facilitates metastasis through lymphovascular remodeling. TNBC cells instigate mRNA changes in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service