Skip to Content
Merck
All Photos(1)

Key Documents

EHU046951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARG2, VTI1B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAGGAGACACTGTGCACTGACATGTTTCACAACAGGCATTCCAGAATTATGAGGCATTGAGGGGATAGATGAATACTAAATGGTTGTCTGGGTCAATACTGCCTTAATGAGAACATTTACACATTCTCACAATTGTAAAGTTTCCCCTCTATTTTGGTGACCAATACTACTGTAAATGTATTTGGTTTTTTGCAGTTCACAGGGTATTAATATGCTACAGTACTATGTAAATTTAAAGAAGTCATAAACAGCATTTATTACCTTGGTATATCATACTGGTCTTGTTGCTGTTGTTCCTTCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bon-Hyeock Koo et al.
Cells, 9(2) (2020-02-13)
Arginase II reciprocally regulates endothelial nitric oxide synthase (eNOS) through a p32-dependent Ca2+ control. We investigated the signaling pathway of arginase II-dependent eNOS phosphorylation. Western blot analysis was applied for examining protein activation and [Ca2+]c was analyzed by microscopic and
Kwanhoon Choi et al.
Molecular medicine reports, 22(3), 2395-2403 (2020-07-25)
The p32 protein plays a crucial role in the regulation of cytosolic Ca2+ concentrations ([Ca2+]c) that contributes to the Ca2+‑dependent signaling cascade. Using an adenovirus and plasmid p32‑overexpression system, the aim of the study was to evaluate the role of p32
Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service