Skip to Content
Merck
All Photos(1)

Key Documents

EHU038261

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB33

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₹23,750.05
50 μG
₹42,412.35

₹23,750.05


Estimated to ship on19 May 2025Details



Select a Size

Change View
20 μG
₹23,750.05
50 μG
₹42,412.35

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₹23,750.05


Estimated to ship on19 May 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGACTGGTTGCAAGGTTTATGCAAATATCGGTGAAGATACTTATGATATAGTGATCCCTGTCAAAGATGACCCTGATGAAGGGGAGGCCAGACTTGAGAATGAAATACCAAAAACGTCTGGCAGCGAGATGGCAAACAAACGTATGAAAGTAAAACATGATGATCACTATGAGTTAATAGTAGATGGAAGGGTCTATTATATCTGTATTGTATGCAAAAGGTCATATGTCTGTCTGACAAGCTTGCGGAGACATTTTAACATTCATTCTTGGGAGAAGAAGTATCCGTGCCGTTACTGTGAGAAGGTATTTCCTCTTGCAGAATATCGCACAAAGCATGAAATTCATCACACAGGGGAGCGAAGGTATCAGTGTTTGGCCTGTGGCAAATCTTTCATCAACTATCAGTTTATGTCTTCACATATAAAGTCAGTTCATAGTCAAGATCCTTCTGGGGACTCAAAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ligang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(3), 947-958 (2018-07-24)
Kaiso (ZBTB33) expression is closely associated with the progression of many cancers and microRNA (miRNA) processing. MiR-181a plays critical roles in multiple cancers; however, its precise mechanisms in glioma have not been well clarified. The goal of this study was
Jacqueline Jones et al.
Clinical & experimental metastasis, 31(5), 497-510 (2014-02-27)
The expression and biological consequences of Kaiso, a novel bi-modal transcription factor, in infiltrating ductal carcinomas (IDCs) have not been widely investigated. In the present study, we determined Kaiso expression and subcellular localization in 146 normal tissues, 376 IDCs, and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service