Skip to Content
Merck
All Photos(1)

Key Documents

EHU001391

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM131

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTCCAAGGACAAGGAACAACTGAGAACTTGAGGGTGGCAGGCAAGCTTCCAGGTCCAGGAAGCTCCTTACGCTTTAAAATCACGGAAGCATTGTTAAAAGATTGTACAGATAGTTTAAAACTAAGAGAACCAAATTTCACATTGAAAAGAACATTTAAGGTAGAGAATACAGGACAACTTCAAATTCACATAGAAACCATTGAAATCAGTGGATACTCATGTGAAGGATATGGCTTTAAAGTTGTTAATTGTCAAGAGTTTACTCTAAGTGCCAATGCTTCTAGAGATATAATCATATTGTTTACTCCTGATTTTACAGCTTCTAGAGTTATTCGGGAACTGAAGTTTATAACAACCAGTGGCTCTGAGTTTGTATTTATATTGAATGCATCCCTTCCTTACCATATGTTAGCAACCTGTGCAGAAGCCCTACCCAGACCT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chao Wang et al.
Journal of cellular biochemistry, 119(2), 1646-1658 (2017-08-05)
The study elucidated the effects associated with silencing growth factor-β R1 (TGF-β R1) and TGF-β R2 genes on the proliferation and apoptosis of penile urethral epithelial cells (UECs) in hypospadiac male rats. Seventy-five male rats were distributed into the normal
Karl E Carlström et al.
Nature communications, 11(1), 4071-4071 (2020-08-15)
Arrest of oligodendrocyte (OL) differentiation and remyelination following myelin damage in multiple sclerosis (MS) is associated with neurodegeneration and clinical worsening. We show that Glutathione S-transferase 4α (Gsta4) is highly expressed during adult OL differentiation and that Gsta4 loss impairs
Yanjie Zhang et al.
Ecotoxicology and environmental safety, 179, 222-231 (2019-05-03)
Hydrogen sulfide (H2S), a multifunctional gasotransmitter, participates in a wide range of cellular signal transduction and pathophysiological processes. Cystathionine gamma-lyase (CSE) acts as a major H2S-generating enzyme in peripheral organs and tissues. As a cysteine-rich and heavy metal-binding protein, metallothionein-1
Yanjie Zhang et al.
Antioxidants & redox signaling, 32(9), 583-601 (2019-12-25)
Aims: The physiological and pathological importance of hydrogen sulfide (H2S) as a novel gasotransmitter has been widely recognized. Cystathionine
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service