Skip to Content
Merck
All Photos(1)

Documents

EMU146171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccr5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCCCTAGGCTTAGTTAGGTTGAAATACCCATTGAGGAAACAGCAAATACAAAGGAAGAATAAAGAGTTTAGCCGGGAAGGTAGTCTCATTTTACAGCCGGAATATAATGTTATCTCAGGCTAGCATTTTGTTCCTGCCTTCAGACCTAAATCCTACCACACCGGGACTGTGAAACACCTGGATTATGAATCATGAGCCTGAGGTCTAGGAATAATAATAACGTTTGTGATTTTAGATGAGGGCTGTTTCCATAGTTTGAAGCCAGAACTTTATCATCTTGAGCAGAAGCTCCAAGAGATGAGGAAAGAGCACCAATTTTTCTCTAATTTACTTAGCAGTCATCATCTCTGGAAGATTCATTTTAGAAACAAGTTGTTGTGCCCCTCAGAAGCCATGAGAGTATAACGACTGCTCTCTGTGTTCCAGGCTGAGTATGAGGACTTCAGTCACACTTTCCAGATGGCTTCTCCACACAAACAATGCTAAGTTTGGCCATTTCAGAGGTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shen Pang et al.
PloS one, 9(5), e96445-e96445 (2014-05-17)
The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression.
S Y Lee et al.
Journal of dental research, 94(12), 1715-1723 (2015-09-12)
Tooth movement by application of orthodontic biophysical force primarily reflects the role of soluble molecules released from the periodontal ligament (PDL). Thus far, many factors have been reported to be involved in orthodontic tooth movement (OTM), but key molecules that
Lanfu Zhao et al.
Acta biochimica et biophysica Sinica, 47(11), 890-898 (2015-09-24)
Glioblastoma (GBM) is the most prevalent malignant primary brain tumor in adults and exhibits a spectrum of aberrantly aggressive phenotype. Tumor cell proliferation and invasion are critically regulated by chemokines and their receptors. Recent studies have shown that the chemokine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service