Skip to Content
Merck
All Photos(1)

Key Documents

EMU000241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Orai3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₪1,086.00
50 μG
₪1,939.00

₪1,086.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
₪1,086.00
50 μG
₪1,939.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₪1,086.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCACCAGTCACCACACCAACGACTGCACAGATACGTGGAGCTTGCCTGGGGCTTCTCTACTGCCTTGGGTACCTTTCTCTTCCTGGCTGAAGTTGTTCTGGTGGGCTGGGTCAAGTTTGTGCCCATTGGGGCACCCATGGGTAAACCAGCTCCTGTTGTACCTATGTCCCAGGTGCCACCTGTGACTGTCTCCCTTAGTTTAGCTTCTAACCTCACACCATCCTCTGCTTCTATTACCACATCACAACAGCCTTCCAAAGCCTGTCCACCCCGGCAAGTGTGTGATAGTGCTCATGGACCAGGCTGGCAGGCAGCTATGGCCTCCACGGCAATCATGGTACCTGTGGGACTAGTGTTTATGGCCTTTGCCCTACATTTCTACCGATCCTTGGTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service