Skip to Content
Merck
All Photos(1)

Documents

EHU159091

Sigma-Aldrich

MISSION® esiRNA

targeting human GPR17

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCTTGTGATGGCTACAATGGCTCCTAGACACTCAACGACTTCATCTGTGGCAGGGAGAGAGGAGGCCGGAAGAACAACCCCTGAACAATGGAGGCCTTTCTTTCCCGCTAGGCTCCCAGCCTCCTTCCCGCTACAGAATCGCTCATCGGCGAGGCTCAGCAGAAAGACCCTGAAGGCAGGCTGCAAATGACCCAGAAGAGGGACCTGGGAGTCCTGGTGGGGACGGGGAGGGAGTCTCAATACTCCTTTGCAGTGCAAGGTACTCTGAGTCCCCTCTGTAGTGCCTCTGCCAGACACACACTGCCTGAGTTGAAGAGACACAGGCCACACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Simona Cosentino et al.
Journal of cellular and molecular medicine, 18(9), 1785-1796 (2014-06-10)
GPR17 is a G(i) -coupled dual receptor activated by uracil-nucleotides and cysteinyl-leukotrienes. These mediators are massively released into hypoxic tissues. In the normal heart, GPR17 expression has been reported. By contrast, its role in myocardial ischaemia has not yet been
Zhangfu Wang et al.
International immunopharmacology, 88, 106870-106870 (2020-08-18)
Osteoarthritis (OA) is a common joint disease affecting millions of elderly people worldwide. However, the mechanism of OA is complicated and remains poorly understood. Thus, a safe and effective therapeutic strategy has yet to be developed. G protein-coupled receptor 17
Bing Zhao et al.
International journal of molecular medicine, 42(5), 2750-2762 (2018-09-19)
GPR17 is a G (i)-coupled dual receptor, linked to P2Y and CysLT receptors stimulated by uracil nucleotides and cysteinyl leukotrienes, respectively. Recent evidence has demonstrated that GPR17 inhibition ameliorates the progression of cerebral ischemic injury by regulating neuronal death and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service