Skip to Content
Merck
All Photos(1)

Key Documents

EHU157281

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAS1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₪1,086.00
50 μG
₪1,939.00

₪1,086.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
₪1,086.00
50 μG
₪1,939.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₪1,086.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGGGCAGTTATGGACACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACTAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACTTAGAGCGGGAGCTGGCAGACCTCCATGGGAAAGATGCCGCACTCTTGTTTTCCTCGTGCTTTGTGGCCAATGACTCAACCCTCTTCACCCTGGCTAAGATGATGCCAGGCTGTGAGATTTACTCTGATTCTGGGAACCATGCCTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTACATCTTCCGCCACAATGATGTCAGCCACCTCAGAGAACTGCTGCAAAGATCTGACCCCTCAGTCCCCAAGATTGTGGCATTTGAAACTGTCCATTCAATGGATGGGGCGGTGTGCCCACTGGAAGAGCTGTGTGATGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yalei Zhao et al.
Saudi journal of gastroenterology : official journal of the Saudi Gastroenterology Association, 26(3), 144-152 (2020-04-10)
Colorectal cancer (CRC) is the third most common malignant tumour worldwide and the second leading cause of cancer-related deaths. Commonly, 5'-aminolevulinic acid synthase1 (ALAS1) is the rate-limiting enzyme for haem biosynthesis. Recent studies have shown that ALAS1 is involved in
Taka-Aki Takeda et al.
Biochimica et biophysica acta, 1861(7), 1813-1824 (2017-03-30)
The degradation of heme significantly contributes to cytoprotective effects against oxidative stress and inflammation. The enzyme heme oxygenase-1 (HO-1), involved in the degradation of heme, forms carbon monoxide (CO), ferrous iron, and bilirubin in conjunction with biliverdin reductase, and is

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service