Skip to Content
Merck
All Photos(1)

Documents

EHU105721

Sigma-Aldrich

MISSION® esiRNA

targeting human PCNA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACA

Ensembl | human accession no.

ENSG00000132646

NCBI accession no.

NM_002592

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PCNA(5111) , PCNA(5111)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Keiichiro Sakuma et al.
Cancer science, 109(8), 2458-2468 (2018-06-06)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL), an RNA-binding protein that regulates alternative splicing of pre-mRNA, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here, we show that HNRNPLL promotes cell cycle progression and
Amy Kwan et al.
Molecular cancer therapeutics, 20(3), 589-601 (2020-12-11)
Oncolytic viruses (OV) have been shown to activate the antitumor functions of specific immune cells like T cells. Here, we show OV can also reprogram tumor-associated macrophage (TAM) to a less immunosuppressive phenotype. Syngeneic, immunocompetent mouse models of primary breast
Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how
N Kanu et al.
Oncogene, 35(30), 4009-4019 (2015-11-10)
The DNA replication machinery invariably encounters obstacles that slow replication fork progression, and threaten to prevent complete replication and faithful segregation of sister chromatids. The resulting replication stress activates ATR, the major kinase involved in resolving impaired DNA replication. In
Joachim Garbrecht et al.
Nucleus (Austin, Tex.), 9(1), 474-491 (2018-09-13)
Fluorescence microscopy in combination with the induction of localized DNA damage using focused light beams has played a major role in the study of protein recruitment kinetics to DNA damage sites in recent years. Currently published methods are dedicated to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service