Skip to Content
Merck
All Photos(1)

Key Documents

EHU096711

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kai Wu et al.
The Journal of international medical research, 47(2), 893-904 (2019-01-09)
The aim of this study was to observe the effect of Ku86 on cellular senescence and apoptosis induced by various doses of ionizing radiation in human umbilical vein endothelial cells (HUVECs). Senescence-associated β-galactosidase activity was detected to evaluate cell senescence.
Damiano Fantini et al.
Molecular biology of the cell, 28(1), 192-200 (2016-12-31)
Damaged DNA-binding protein 2 (DDB2), a nuclear protein, participates in both nucleotide excision repair and mRNA transcription. The transcriptional regulatory function of DDB2 is significant in colon cancer, as it regulates metastasis. To characterize the mechanism by which DDB2 participates
Katerina Jerabkova et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12751-12767 (2020-08-02)
Equal segregation of chromosomes during mitosis ensures euploidy of daughter cells. Defects in this process may result in an imbalance in the chromosomal composition and cellular transformation. Proteolytic and non-proteolytic ubiquitylation pathways ensure directionality and fidelity of mitotic progression but
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines
Prashant Rai et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(26), E3421-E3430 (2015-06-17)
Streptococcus pneumoniae is a leading cause of pneumonia and one of the most common causes of death globally. The impact of S. pneumoniae on host molecular processes that lead to detrimental pulmonary consequences is not fully understood. Here, we show

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service