Skip to Content
Merck
All Photos(1)

Documents

EHU071391

Sigma-Aldrich

MISSION® esiRNA

targeting human SIAH1, LONP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAGTCCATTACAACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTGATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACCAGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGACTTGAGCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAAGGAATTGCAACAGCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management
Yang He et al.
Molecular cancer research : MCR, 17(5), 1129-1141 (2019-02-24)
Patients suffering from glioblastoma have a dismal prognosis, indicating the need for new therapeutic targets. Here we provide evidence that the DNA damage kinase HIPK2 and its negative regulatory E3-ubiquitin ligase SIAH1 are critical factors controlling temozolomide-induced cell death. We
Sujeong Yeom et al.
The Journal of general virology, 98(7), 1774-1784 (2017-07-18)
The seven in absentia homologue 1 (Siah-1) protein is an E3 ubiquitin ligase that induces ubiquitin-dependent proteasomal degradation of HBx, the principal regulatory protein of hepatitis B virus (HBV); however, its role in HBV propagation remains unknown. Here, we found

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service