Skip to Content
Merck
All Photos(1)

Documents

EHU053851

Sigma-Aldrich

MISSION® esiRNA

targeting human PROX1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTCTCCTTGTCGCTCATAAAGTCCGAGTGCGGCGATCTTCAAGATATGTCTGAAATATCACCTTATTCGGGAAACTCTATGGAGGAAGGATTGTCACCCAATCACTTGAAAAAAGCAAAGCTCATGTTTTTTTATACCCGTTATCCCAGCTCCAATATGCTGAAGACCTACTTCTCCGACGTAAAGTTCAACAGATGCATTACCTCTCAGCTCATCAAGTGGTTTAGCAATTTCCGTGAGTTTTACTACATTCAGATGGAGAAGTACGCACGTCAAGCCATCAACGATGGGGTCACCAGTACTGAAGAGCTGTCTATAACCAGAGACTGTGAGCTGTACAGGGCTCTGAACATGCACTACAATAAAGCAAATGACTTTGAGGTTCCAGAGAGATTCCTGGAAGTTGCTCAGATCACATTACGGGAGTTTTTCAATGCCATTATCGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chang Rae Rho et al.
Investigative ophthalmology & visual science, 56(10), 5871-5879 (2015-09-09)
Prospero homeobox 1 (Prox1) siRNA is a small interfering RNA that is designed to specifically bind Prox1 mRNA. We determined whether Prox1 siRNA inhibits lymphangiogenesis and hemangiogenesis after acute corneal inflammation. Three Prox1 siRNAs were synthesized and investigated for their
Toshihiko Goto et al.
FEBS letters, 591(4), 624-635 (2017-01-28)
Previous reports have revealed that Prospero-related homeobox 1 (Prox1) is required for the migration and differentiation of hepatoblasts during embryonic liver formation. However, the role of Prox1 in adults remains to be elucidated. We created liver-specific Prox1 knockout mice to
Kang-Jin Park et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(1), 104-115 (2016-01-14)
Prospero homeobox 1 (PROX1) functions as a tumor suppressor gene or an oncogene in various cancer types. However, the distinct function of PROX1 in gastric cancer is unclear. We determined whether PROX1 affected the oncogenic behavior of gastric cancer cells
Tomonori Sasahira et al.
PloS one, 9(3), e92534-e92534 (2014-03-22)
Prospero homeobox 1 (Prox1) and forkhead box (FOX) C2 regulate angiogenesis and/or lymphangiogenesis. However, the detailed role and function of Prox1 and FOXC2 in cancer remains controversial. In the present study, we examined the expression of Prox1 and FOXC2 proteins
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service