Skip to Content
Merck
All Photos(1)

Key Documents

EHU012661

Sigma-Aldrich

MISSION® esiRNA

targeting human PEBP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATAGACCCACCAGCATTTCGTGGGATGGTCTTGATTCAGGGAAGCTCTACACCTTGGTCCTGACAGACCCGGATGCTCCCAGCAGGAAGGATCCCAAATACAGAGAATGGCATCATTTCCTGGTGGTCAACATGAAGGGCAATGACATCAGCAGTGGCACAGTCCTCTCCGATTATGTGGGCTCGGGGCCTCCCAAGGGCACAGGCCTCCACCGCTATGTCTGGCTGGTTTACGAGCAGGACAGGCCGCTAAAGTGTGACGAGCCCATCCTCAGCAACCGATCTGGAGACCACCGTGGCAAATTCAAGGTGGCGTCCTTCCGTAAAAAGTATGAGCTCAGGGCCCCGGTGGCTGGCACGTGTTACCAGGCCGAGTGGGATGACTATGTGCCCAAACTGTACGAGCAGCTGTCTGGGAAGTAGGGGGTTAGCTTGGGGACCTGAACTGTCCTGGAGGCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTTCTCCTCTTCCTGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zixuan Gong et al.
Cancer management and research, 12, 9327-9338 (2020-10-17)
Much evidence unveils the significance of long non-coding RNAs (lncRNAs) in diverse cancers. This study was designed to clarify the function and mechanism of lncRNA GATA6 antisense RNA 1 (GATA6-AS1) in the progression of non-small cell lung cancer (NSCLC). GATA6-AS1
Andrey Kazakov et al.
Basic research in cardiology, 113(6), 42-42 (2018-09-08)
Fibrosis is a hallmark of maladaptive cardiac remodelling. Here we report that genome-wide quantitative trait locus (QTL) analyses in recombinant inbred mouse lines of C57BL/6 J and DBA2/J strains identified Raf Kinase Inhibitor Protein (RKIP) as genetic marker of fibrosis progression.
Yun Wang et al.
Oncology reports, 34(4), 2106-2114 (2015-08-05)
The Raf kinase inhibitor protein (RKIP) is a novel metastasis suppressor. RKIP was previously found to have low expression in a colorectal cancer (CRC) patient cohort by immunohistochemistry. However, the role of RKIP in CRC remains undetermined. In the present
Quanfang Huang et al.
Journal of cellular biochemistry, 120(4), 6168-6177 (2018-10-12)
The purpose of this study was to investigate the effect of Raf kinase inhibitor protein (RKIP) on the growth, apoptosis, invasion, and metastasis of human hepatic stellate cell line (LX-2). A recombinant plasmid (pcDNA3.1-RKIP) or RKIP-targeting small interfering RNA (siRNA)
Martha Lappas
Reproduction (Cambridge, England), 153(5), 545-553 (2017-03-11)
Nuclear factor-kappa B (NF-κB)-induced inflammation plays a central role in the terminal process of human labor and delivery. Our previous studies show that IL1B induces NF-κB signaling through extracellular signal-regulated kinase (ERK; official gene symbol MAPK1), whereas TNF induces NF-κB-driven

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service