Skip to Content
Merck
All Photos(1)

Documents

EHU005441

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGTCTTTGCCTGAAATGGTGAGTAAGGAAAGCGAAAGGCTGAGCATAACTAAATCTGCCTGTGGAAGAAATGGCAAACAATTCTGCAGTACTTTAACCTTGAACACAGCTCAAGCAAACCACACTGGCTTCTACAGCTGCAAATATCTAGCTGTACCTACTTCAAAGAAGAAGGAAACAGAATCTGCAATCTATATATTTATTAGTGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATACACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTGTTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGGACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCTGTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCAATACAATCATAGATGTCCAAATAAGCACACCACGCCCAGTCAAATTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jaewoo Hong et al.
Cancers, 12(6) (2020-05-31)
The vascular response to hypoxia and ischemia is essential for maintaining homeostasis during stressful conditions and is particularly critical for vital organs such as the heart. Hypoxia-inducible factor-1 (HIF-1) is a central regulator of the response to hypoxia by activating
Jun Yu et al.
Placenta, 58, 1-8 (2017-10-01)
Excessive circulating sFlt1 plays a major role in the pathogenesis of preeclampsia (PE). Using RNAi to silence sFlt1 may be a therapy for treating PE. Because of the rapid degradation of siRNA, gene therapy in vivo remains limited. Poly-amidoamine (PAMAM) has
Ramcharan Singh Angom et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4626-4637 (2018-12-24)
Aggregated amyloid β (Aβ) peptides in the Alzheimer's disease (AD) brain are hypothesized to trigger several downstream pathologies, including cerebrovascular dysfunction. Previous studies have shown that Aβ peptides can have antiangiogenic properties, which may contribute to vascular dysfunction in the
Jessica E Nesmith et al.
Development (Cambridge, England), 144(5), 889-896 (2017-03-02)
Blood vessel formation is essential for vertebrate development and is primarily achieved by angiogenesis - endothelial cell sprouting from pre-existing vessels. Vessel networks expand when sprouts form new connections, a process whose regulation is poorly understood. Here, we show that
San Xu et al.
Oncology reports, 40(1), 377-384 (2018-05-12)
The Epstein-Barr virus latent membrane protein 1 (EBV‑LMP1) is an oncoviral protein that plays an important role in oncogenic transformation in EBV‑associated nasopharyngeal carcinoma (NPC). Our previous studies demonstrated that LMP1 increased VEGFA expression and upregulated angiogenesis in NPC. Vasculogenic mimicry (VM)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service