Skip to Content
Merck
All Photos(1)

Key Documents

EMU048091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt3a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGAAATGCCACTGTGTTTTCCATTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACACGTGTCTATGACGTGCACACCTGCAAGTAGGAGAGCTCCTAACACGGGAGCAGGGTTCATTCCGAGGGGCAAGGTTCCTACCTGGGGGCGGGGTTCCTACTTGGAGGGGTCTCTTACTTGGGGACTCGGTTCTTACTTGAGGGCGGAGATCCTACCTGTGAGGGTCTCATACCTAAGGACCCGGTTTCTGCCTTCAGCCTGGGCTCCTATTTGGGATCTGGGTTCCTTTTTAGGGGAGAAGCTCCTGTCTGGGATACGGGTTTCTGCCCGAGGGTGGGGCTCCACTTGGGGATGGAATTCCAATTTGGGCCGGAAGTCCTACCTCAATGGCTTGGACTCCTCTCTTGACCCGACAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Xia Yu et al.
American journal of cancer research, 7(11), 2144-2156 (2017-12-09)
Therapeutic antibodies targeting colony stimulating factor 1 receptor (CSF-1R) to block colony stimulating factor-1/colony stimulating factor 1 receptor (CSF-1/CSF-R) signaling axis have exhibit remarkable efficacy in the treatment of malignant tumor. Yet, little is known about the effects of intrinsic
Hui Xu et al.
Oncology reports, 41(2), 1180-1188 (2018-11-16)
Fine particulate matter (PM2.5) is associated with an increased lung cancer risk. However, the effect of PM2.5 exposure on lung cancer cells is still largely unknown. The present study revealed that A549 lung cancer cells secreted exosomes containing high levels
Xianxian Jia et al.
International journal of molecular medicine, 47(1), 195-206 (2020-11-26)
Arrested alveolar development is the main pathological characteristic of neonatal bronchopulmonary dysplasia (BPD); however, a number of studies aiming to improve alveolarization have focused on alveolar epithelial cell damage and impairment. Previously, the authors reported that the Wnt signaling plays
Jaewoong Jang et al.
Scientific reports, 7, 41612-41612 (2017-01-28)
In this study, LPS-induced inflammatory responses in BEAS-2B human bronchial epithelial cells and human umbilical vein endothelial cell (HUVEC)s were found to be prevented by Dickkopf-1 (DKK-1), a secreted Wnt antagonist, and LGK974, a small molecular inhibitor of the Wnt
Weifeng Zou et al.
Respiratory physiology & neurobiology, 221, 1-10 (2015-10-17)
A deficiency of surfactant proteins A and D has been proposed as a mechanism in airway remodeling, which is one characteristic of chronic obstructive pulmonary disease (COPD). We recently showed that in vitro nicotine exposure induces Wnt3a/β-catenin activation, which is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service