Skip to Content
Merck
All Photos(1)

Documents

EMU029651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt10a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCTGGGTCTCAAGAATGGTTGTCCTCTTGGTGCCTGGCTTCTGCCGCTAGCGGATCTGAGCCAGGCAGCAAGCAGCAGCCTTGGCTCCTGAGAGAGGTGGTTGGCTCTTACAGCCCCGAGGGTCTACAATCACCAGACAGTCCAGATCTGATTGACATTCCTCCGCTCACCTCTGTAGGTTCCCCTCTTTCTGTTCCTAGCTCAGACAGCTGGGGGTGATAGTGGAGACTGTTCCACACCCTAGGACAGGTCACCAAAGCAGCCCAGCCTGGCATGCCTACCTCCTGTCATCTCTTCTTCCCTTCCCCAGGAGTGATAGGCAATGCACTGAAGCTGATGGGCACCGGGGAAGAAAACTAAAAGGCAGAAATGGCCGTCATCGGGCTGAAGTGACTCTAAGGGCTCCAGACCTCTGCTCCTGTCTTTCACTTAACAGATATTTATTTTTGCGCTCTCTTTGAGACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ren-Jun Hsu et al.
PloS one, 7(10), e47649-e47649 (2012-10-25)
Renal cell carcinoma (RCC) is a malignancy with poor prognosis. WNT/β-catenin signaling dysregulation, especially β-catenin overactivation and WNT antagonist silencing, is associated with RCC carcinogenesis and progression. However, the role of WNT ligands in RCC has not yet been determined.
Fujun Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2409-2420 (2016-11-11)
Wnt/β-catenin pathway is involved in liver fibrosis and microRNAs (miRNAs) are considered as key regulators of the activation of hepatic stellate cells (HSCs). A recent study showed the protective role of miR-378a-3p against cardiac fibrosis. However, whether miR-378a-3p suppresses Wnt/β-catenin
Jia Jing et al.
Adipocyte, 9(1), 401-414 (2020-07-24)
We discovered a unique expression pattern of two histone methyltransferases Suv39h1 and Suv39h2 during 3T3-L1 adipogenesis, both of which preferentially catalyse the formation of H3K9 dimethylation (H3K9me2) and further H3K9 trimethylation (H3K9me3), a transcriptional repressive mark. The expression of Suv39h1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service