Skip to Content
Merck
All Photos(1)

Key Documents

EHU139841

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCAGGACCAGTTTCCATAGACTGCGGACTGGGGTCTTCCTCCAGCAGTTACTTGATGCCCCCTCCCCCGACACAGACTCTCAATCTGCCGGTGGTAAGAACCGGTTCTGAGCTGGCGTCTGAGCTGCTGCGGGGTGGAAGTGGGGGGCTGCCCACTCCACTCCTCCCATCCCCTCCCAGCCTCCTCCTCCGGCAGGAACTGAACAGAACCACAAAAAGTCTACATTTATTTAATATGATGGTCTTTGCAAAAAGGAACAAAACAACACAAAAGCCCACCAGGCTGCTGCTTTGTGGAAAGACGGTGTGTGTCGTGTGAAGGCGAAACCCGGTGTACATAACCCCTCCCCCTCCGCCCCGCCCCGCCCGGCCCCGTAGAGTCCCTGTCGCCCGCCGGCCCTGCCTGTAGATACGCCCCGCTGTCTGTGCTGTGAGAGTCGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuji Atsuta et al.
Development (Cambridge, England), 143(19), 3549-3559 (2016-09-01)
The Müllerian duct (MD) and Wolffian duct (WD) are embryonic tubular tissues giving rise to female and male reproductive tracts, respectively. In amniote embryos, both MD and WD emerge in both sexes, but subsequently degenerate in the males and females
Imlimaong Aier et al.
PloS one, 14(10), e0223554-e0223554 (2019-10-18)
Pancreatic ductal adenocarcinoma (PDAC) is notoriously difficult to treat due to its aggressive, ever resilient nature. A major drawback lies in its tumor grade; a phenomenon observed across various carcinomas, where highly differentiated and undifferentiated tumor grades, termed as low
Nan Jia et al.
Oncotarget, 7(51), 84785-84797 (2016-10-21)
This work investigated the role of paired box 2 (PAX2) in endometrial cancer and its epigenetic regulation mechanism. Endometrial cancer tissues and cell lines exhibited increased PAX2 expression compared with hyperplasia, normal endometrium and endometrial epithelial cells. Knock-down of PAX2
Huanyu Zhao et al.
Molecular carcinogenesis, 54 Suppl 1, E112-E121 (2014-08-27)
Dishevelled-3 (Dvl-3) and p120-catenin (p120ctn) have abnormal expression in non-small cell lung cancer (NSCLC), which is associated with poor prognosis. Dvl-3 upregulates p120ctn transcription in NSCLC cells, but the mechanism is unknown. Here we transiently transfected Dvl-3 cDNA to NSCLC

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service