Skip to Content
Merck
All Photos(1)

Key Documents

EHU138301

Sigma-Aldrich

MISSION® esiRNA

targeting human MGRN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCATCTACTGCCAGGCATCGGAGGAGTTCCTGAACGGCAGGGCAGTATACAGCCCCAAGAGCCCCTCGCTACAGTCCGAGACCGTCCACTACAAGAGAGGGGTGAGCCAGCAGTTCTCCCTGCCCTCCTTCAAGATTGACTTCTCGGAATGGAAGGATGACGAGCTGAACTTTGACCTGGACCGGGGCGTGTTTCCAGTAGTCATCCAGGCTGTGGTGGACGAAGGAGATGTGGTGGAAGTGACTGGCCACGCCCACGTGCTCTTGGCTGCCTTTGAAAAGCACATGGACGGCAGCTTCTCTGTGAAGCCTTTAAAGCAGAAGCAAATTGTGGACCGGGTCAGCTACCTCCTGCAGGAGATCTATGGCATTGAGAACAAGAACAACCAGGAGACCAAGCCCTCGGACGACGAGAACAGCGACAACAGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Karen Legler et al.
British journal of cancer, 118(6), 847-856 (2018-01-31)
Alterations in protein glycosylation have been related to malignant transformation and tumour progression. We recently showed that low mRNA levels of Golgi alpha-mannosidase MAN1A1 correlate with poor prognosis in breast cancer patients. We analysed the role of MAN1A1 on a
Min Deng et al.
Molecular medicine reports, 20(1), 368-374 (2019-05-23)
The activation of hepatic stellate cells (HSCs) is considered associated with liver fibrosis. However, the exact role of syndecan‑1 (SDC1), a protein that regulates the interaction between cells and the microenvironment, in the activation of HSCs resulting in liver fibrosis
Hao Gao et al.
Cell cycle (Georgetown, Tex.), 18(12), 1393-1406 (2019-05-28)
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential
Ye Chun Ruan et al.
Journal of cell science, 127(Pt 20), 4396-4408 (2014-08-12)
Mutations in CFTR lead to dysfunction of tubular organs, which is currently attributed to impairment of its conductive properties. We now show that CFTR regulates tight junction assembly and epithelial cell differentiation through modulation of the ZO-1-ZONAB pathway. CFTR colocalizes

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service