Skip to Content
Merck
All Photos(1)

Documents

EHU127561

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGGACGATAAGACCGTGTATGAGTACCTGTTCAGCCAGCGGCGAAAACGGCGGGCCCCACTGGCCACTCGCCAGGGCAAGCGACCCAGCAAGAACCTTAAGGCTCGCTGCAGTCGGAAGGCACTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCACCCCTTGAGTACGAGGCTTTCCACTGCGAGGGGCTGTGCGAGTTCCCATTGCGCTCCCACCTGGAGCCCACGAATCATGCAGTCATCCAGACCCTGATGAACTCCATGGACCCCGAGTCCACACCACCCACCTGCTGTGTGCCCACGCGGCTGAGTCCCATCAGCATCCTCTTCATTGACTCTGCCAACAACGTGGTGTATAAGCAGTATGAGGACATGGTCGTGGAGTCGTGTGGCTGCAGGTAGCAGCACTGGCCCTCTGTCTTCCTGGGTGGCACATCCCAAGAGCCCCTTCCTGCACTCCTGGAATCACAGAGGGGTCAGGAAGCTGTGGCAGGAGCATCTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Md Fahmid Islam et al.
Scientific reports, 7(1), 1040-1040 (2017-04-23)
Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This
Wei Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1414-1421 (2016-10-25)
The precise role of interleukin-1 beta (IL-1β)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation
Dagmara M Wiatrek et al.
RNA (New York, N.Y.), 25(6), 713-726 (2019-03-22)
Viral and cellular double-stranded RNA (dsRNA) is recognized by cytosolic innate immune sensors, including RIG-I-like receptors. Some cytoplasmic dsRNA is commonly present in cells, and one source is mitochondrial dsRNA, which results from bidirectional transcription of mitochondrial DNA (mtDNA). Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service