Skip to Content
Merck
All Photos(1)

Key Documents

EHU124061

Sigma-Aldrich

MISSION® esiRNA

targeting human TSG101

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jiin-Tsuey Cheng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 134, 111106-111106 (2020-12-19)
Tumor Susceptibility Gene 101 (TSG101) is a member of endosomal sorting complexes responsible for endocytic pathway, which is associated with autophagic process. However, the role of TSG101 in autophagy remains unclear. To investigate the effect of TSG101 on the membrane-bound
Hamish W King et al.
BMC cancer, 12, 421-421 (2012-09-25)
Exosomes are nanovesicles secreted by tumour cells which have roles in paracrine signalling during tumour progression, including tumour-stromal interactions, activation of proliferative pathways and bestowing immunosuppression. Hypoxia is an important feature of solid tumours which promotes tumour progression, angiogenesis and
Chen Xu et al.
Cellular & molecular biology letters, 24, 7-7 (2019-01-25)
The tumor susceptibility gene 101 (TSG101) is closely associated with various tumor types, but its role in the pathogenesis of renal cell carcinoma (RCC) is still unknown. This study used RNA interference to silence the expression of TSG101 in RCC
Rutuja Kulkarni et al.
Scientific reports, 7(1), 14787-14787 (2017-11-03)
Exosomes are membrane enclosed nano-sized vesicles actively released into the extracellular milieu that can harbor genomic, proteomic and lipid cargos. Functionally, they are shown to regulate cell-cell communication and transmission of pathogens. Though studies have implicated a role for exosomes
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service