Skip to Content
Merck
All Photos(1)

Key Documents

EHU122081

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG2A

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€200.00
50 μG
€354.00

€200.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€200.00
50 μG
€354.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€200.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGAAGGGAGAGGAACTGGAGCTGTCAGTGGAGAGTCCCTGTGAGCTGCGGGAACCTGAGCCCTCGCCCTTCTCCTCTAAGAGGACCATGTATGAGACAGAGGAGATGGTGATCCCTGGAGACCCTGAGGAGATGAGGACGTTCCAGAGCCGGACCCTGGCACTGTCCCGCTGCAGCCTGGAAGTGATCCTGCCCAGTGTCCACATCTTTCTGCCCAGCAAGGAGGTCTACGAGAGCATCTACAACAGGATCAACAACGACCTGCTCATGTGGGAGCCTGCAGATCTGCTTCCCACCCCCGACCCCGCCGCCCAGCCCTCGGGCTTCCCCGGCCCCTCAGGCTTCTGGCACGACAGCTTTAAGATGTGCAAGTCAGCCTTCAAGCTGGCCAACTGCTTTGATCTCACCCCAGACTCGGACTCGGATGACGAGGATGCCCACTTCTTCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Li et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(12), 16716-16735 (2020-10-31)
Mounting evidence from epidemiological and clinical studies has revealed marked correlations between the air pollutant fine particulate matter (FPM) and respiratory diseases. FPM reaches distal airways and deposits in alveolar regions where it can act directly on alveolar macrophages. However
Simon G Pfisterer et al.
Journal of lipid research, 55(7), 1267-1278 (2014-04-30)
Autophagy is a lysosomal bulk degradation pathway for cytoplasmic cargo, such as long-lived proteins, lipids, and organelles. Induced upon nutrient starvation, autophagic degradation is accomplished by the concerted actions of autophagy-related (ATG) proteins. Here we demonstrate that two ATGs, human

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service