Skip to Content
Merck
All Photos(1)

Key Documents

EHU116941

Sigma-Aldrich

MISSION® esiRNA

targeting human ZFX (1)

Sign Into View Organizational & Contract Pricing

Select a Size

250 MG
$195.50
1 G
$434.70
5 G
$1,199.45
25 G
$4,198.65

Vendor SKU: A344468-250MG

$195.50


Ships in 7 days - from Aldrich Partner.


Select a Size

Change View
250 MG
$195.50
1 G
$434.70
5 G
$1,199.45
25 G
$4,198.65

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Vendor SKU: A344468-250MG

$195.50


Ships in 7 days - from Aldrich Partner.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCATATTCTCTCAGTTCACACAAAGGATCTTCCATTTAGGTGCAAGAGATGTAGAAAGGGATTTAGGCAACAGAGTGAGCTTAAAAAGCATATGAAGACACACAGTGGCAGGAAAGTGTATCAGTGTGAGTACTGTGAGTATAGCACTACAGATGCCTCAGGCTTTAAACGGCACGTTATTTCCATTCACACGAAAGACTATCCTCACCGGTGTGAGTACTGCAAGAAAGGCTTCCGAAGACCTTCAGAAAAGAACCAGCACATAATGCGACATCATAAAGAAGTTGGCCTGCCCTAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoling Song et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(1), 274-284 (2018-07-17)
The role of ZFX in tumourigenesis is unclear. We aimed to study ZFX expression, regulation, and function and the clinical implications of this protein in human pancreatic cancer (PCa). One hundred and twenty patients with histologically confirmed PCa who underwent

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service