Skip to Content
Merck
All Photos(1)

Documents

EHU111621

Sigma-Aldrich

MISSION® esiRNA

targeting human TPT1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seong-Yeon Bae et al.
Scientific reports, 5, 8061-8061 (2015-01-28)
Translationally controlled tumor protein (TCTP), is a highly conserved protein involved in fundamental processes, such as cell proliferation and growth, tumorigenesis, apoptosis, pluripotency, and cell cycle regulation. TCTP also inhibits Na,K-ATPase whose subunits have been suggested as a marker of
Ruilin Sun et al.
OncoTargets and therapy, 12, 1641-1653 (2019-03-19)
Lung cancer is the most common and lethal malignancy worldwide. TCTP is highly expressed in various cancers including lung cancer. Epithelial-mesenchymal transition (EMT) could increase cancer cell invasion. Whether TCTP's expression is associated with EMT in lung adenocarcinoma is largely
Jian-Hui Shen et al.
Biotechnology and applied biochemistry, 63(1), 5-14 (2014-12-20)
Osteosarcoma (OS) remains the most frequent primary malignant bone tumor in adolescents. However, the molecular cause of the disease is poorly elucidated. In the present study, we primarily found that translationally controlled tumor protein (TCTP) was overexpressed in human OS
Mari Kaarbø et al.
PloS one, 8(7), e69398-e69398 (2013-07-31)
TCTP has been implicated in a plethora of important cellular processes related to cell growth, cell cycle progression, malignant transformation and inhibition of apoptosis. In addition to these intracellular functions, TCTP has extracellular functions and plays an important role in
Jian Zhang et al.
International journal of biological sciences, 16(14), 2612-2627 (2020-08-15)
MiR-216a-5p has opposite effects on tumorigenesis and progression in the context of different tumors, acting as either a tumor suppressor or an oncogene. However, the expression and function of miR-216a-5p in pancreatic cancer (PC) is not well characterized. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service