Product EHU084381 has not been tested internally in mouse but the esiRNA cDNA target sequence for EHU084381 has 100% homology against Mus musculus lysine demethylase 5B (Kdm5b), mRNA, NM_152895.2.
Select a Size
€200.00
Select a Size
About This Item
€200.00
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGCATTATCGCTTGCTTCATCGATATTGTGTGTTTTCCCACGATGAGATGATCTGCAAGATGGCTTCCAAGGCTGATGTATTAGATGTTGTAGTGGCTTCAACTGTTCAGAAAGACATGGCCATTATGATTGAGGATGAGAAAGCTTTAAGAGAAACTGTCCGTAAATTGGGAGTGATTGATTCGGAAAGAATGGATTTTGAGCTGTTGCCAGATGATGAACGTCAGTGTGTAAAATGCAAAACTACATGCTTCATGTCTGCCATCTCCTGTTCTTGTAAACCTGGCCTTCTTGTTTGCCTGCATCATGTAAAAGAATTGTGTTCCTGTCCTCCTTACAAATATAAATTGCGGTATAGGTACACGCTGGATGATCTCTACCCTATGATGAATGCATTGAAGCTTCGAGCAGAATCTTACAACGAATGGGCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KDM5B(10765) , JARID1B(10765)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
-
Hi - could you please let me know if esiRNA against KDM5B (human) also targets the mouse transcript? Thank you!
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service