Skip to Content
Merck
All Photos(1)

Key Documents

EHU033221

Sigma-Aldrich

MISSION® esiRNA

targeting human TYROBP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATACAGACCCACAGAGTGCCATCCCTGAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Teng Jiang et al.
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 39(13), 2949-2962 (2014-07-23)
Triggering receptor expressed on myeloid cells 2 (TREM2) gene is a recently identified susceptibility gene for Alzheimer's disease (AD), as its low-frequency variants increase the risk of this disease with an odds ratio similar to that of an APOE ɛ4
Tania N Crotti et al.
Arthritis research & therapy, 14(6), R245-R245 (2012-11-14)
The immunoreceptor tyrosine-based activation motif (ITAM) pathway provides osteoclast co-stimulatory signals and regulates proliferation, survival and differentiation of effector immune cells. In the osteoclast, the receptors Triggering Receptor Expressed on Myeloid cells 2 (TREM2) and Osteoclast Associated Receptor (OSCAR) and
Kevin Carrasco et al.
Cellular & molecular immunology, 16(5), 460-472 (2018-03-24)
The triggering receptor expressed on myeloid cells-1 (TREM-1) is a receptor expressed on innate immune cells. By promoting the amplification of inflammatory signals that are initially triggered by Toll-like receptors (TLRs), TREM-1 has been characterized as a major player in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service