Skip to Content
Merck
All Photos(1)

Documents

EHU011481

Sigma-Aldrich

MISSION® esiRNA

targeting human PROM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCGGAAACTGGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCAGAGCAAATCAAATATATATTGGCCCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGAACAGTATCAATTCAGTGCTAGGAGGCGGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCTTGATGAGATTAAGTCCATGGCAACAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTGAATAGCAACCCTGAACTGAGGCAGCTTCCACCCGTGGATGCAGAACTTGACAACGTTAATAACGTTCTTAGGACAGATTTGGATGGCCTGGTCCAACAGGGCTATCAATCC

Ensembl | human accession no.

ENSG00000007062

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PROM1(8842) , PROM1(8842)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jong Woo Park et al.
Molecules (Basel, Switzerland), 25(14) (2020-07-12)
The pharmacological effects of BST204-a fermented ginseng extract-on several types of cancers have been reported. However, the effects of ginseng products or single ginsenosides against cancer stem cells are still poorly understood. In this study, we identified the anti-tumorigenic and
Liang-Yu Lin et al.
Cardiovascular diabetology, 13, 111-111 (2014-07-17)
Circulating endothelial progenitor cells (EPCs) reflect endothelial repair capacity and may be a significant marker for the clinical outcomes of cardiovascular disease. While some high-dose statin treatments may improve endothelial function, it is not known whether different statins may have
Yanli Jin et al.
BMC cancer, 15, 226-226 (2015-04-18)
Acute lymphoblastic leukemia (ALL) is a heterogeneous group of malignant disorders derived from B- or T-cell lymphoid progenitor cells. ALL often is refractory to or relapses after treatment; thus, novel targeted therapy for ALL is urgently needed. In the present
Hideki Izumi et al.
Scientific reports, 9(1), 2236-2236 (2019-02-21)
CD133 is a transmembranous protein that mainly localises to the plasma membrane in haematopoietic and neural stem cells as well as cancer stem cells. Although CD133 also localises to the cytoplasm, the mechanism of action and function of cytoplasmic CD133
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service