Skip to Content
Merck
All Photos(1)

Documents

EHU010531

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGACAGCGACAAGAAGTGGGGCTTCTGCCCGGACCAAGGATACAGTTTGTTCCTCGTGGCGGCGCATGAGTTCGGCCACGCGCTGGGCTTAGATCATTCCTCAGTGCCGGAGGCGCTCATGTACCCTATGTACCGCTTCACTGAGGGGCCCCCCTTGCATAAGGACGACGTGAATGGCATCCGGCACCTCTATGGTCCTCGCCCTGAACCTGAGCCACGGCCTCCAACCACCACCACACCGCAGCCCACGGCTCCCCCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTCAGAGCGCCCCACAGCTGGCCCCACAGGTCCCCCCTCAGCTGGCCCCACAGGTCCCCCCACTGCTGGCCCTTCTACGGCCACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACG

Ensembl | human accession no.

ENSG00000100985

NCBI accession no.

NM_004994

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MMP9(4318) , MMP9(4318)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jiaoli Wang et al.
Oncotarget, 8(47), 81880-81891 (2017-11-16)
Obesity is involved in tumor progression. However, the corresponding mechanisms remain largely unknown. Here, we report that adipocytes increase the invasive ability of tumor cells by producing exosomes with a high level of MMP3. Compared with 3T3-L1 cells, 3T3-L1 adipocytes
Le-Ping Yan et al.
Materials science & engineering. C, Materials for biological applications, 114, 111022-111022 (2020-10-01)
Impaired wound healing of diabetic foot ulcers has been linked to high MMP-9 levels at the wound site. Strategies aimed at the simultaneous downregulation of the MMP-9 level in situ and the regeneration of impaired tissue are critical for improved
Haibin Lu et al.
American journal of translational research, 9(12), 5361-5374 (2018-01-10)
Tumor-associated neutrophils (TANs) promote metastasis of multiple cancers, including oral squamous cell carcinoma (OSCC). Melatonin (Mel) reportedly exerts anti-metastatic effects on OSCC. However, little is known about the anti-OSCC effects of Mel involved in TANs. In this study, intensive infiltration
Hang Lin et al.
FEBS open bio, 7(9), 1291-1301 (2017-09-15)
Dysregulation of sirtuin 6 (SIRT6) is actively involved in tumor progression. High levels of SIRT6 have been associated with hepatocellular carcinoma and non-small cell lung cancer, and SIRT6 facilitates growth and metastasis of cancer cells. However, the clinical significance and
Xue Bai et al.
OncoTargets and therapy, 10, 2837-2847 (2017-06-28)
Epithelial-mesenchymal transition (EMT) is thought to be a crucial event during the early metastasis of tumor cells. Transforming growth factor (TGF)-β1 is involved in the process of EMT in a variety of human malignancies. Matrix metalloproteinase (MMP)-9 plays an important
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service