Skip to Content
Merck
All Photos(1)

Documents

EHU000841

Sigma-Aldrich

MISSION® esiRNA

targeting human KIT

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTACAACGATGTGGGCAAGACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCACACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATTGTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCTTTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACTGTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCTGAAC

Ensembl | human accession no.

ENSG00000157404

NCBI accession no.

NM_000222

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIT(3815) , KIT(3815)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sook-Kyoung Heo et al.
Scientific reports, 7(1), 15278-15278 (2017-11-12)
Dasatinib and radotinib are oral BCR-ABL tyrosine kinase inhibitors that were developed as drugs for the treatment of chronic myeloid leukemia. We report here that the c-KIT (CD117) targeting with dasatinib and radotinib promotes acute myeloid leukemia (AML) cell death
Kyung-Hwa Lee et al.
Oncotarget, 6(5), 3240-3253 (2015-01-22)
KITENIN (KAI1 COOH-terminal interacting tetraspanin) promotes tumor invasion and metastasis in various cancers. This study assessed the association between KITENIN expression and advanced glioma grade in patients. In vitro assays revealed that KITENIN knockdown inhibited the invasion and migration of
Erola Ainsua-Enrich et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4309-4318 (2015-03-27)
SH3-binding protein 2 (3BP2) is a cytoplasmic adaptor protein that acts as a positive regulator in mast cell FcεRI-dependent signaling. The KIT receptor whose ligand is the stem cell factor is necessary for mast cell development, proliferation, and survival as
Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Yanli Jin et al.
Cancer letters, 353(1), 115-123 (2014-08-05)
Gain-of-function mutations of receptor tyrosine kinase KIT play a critical role in the pathogenesis of systemic mastocytosis (SM) and gastrointestinal stromal tumors. D816V KIT mutation, found in ∼80% of SM, is resistant to the currently available tyrosine kinase inhibitors (TKIs)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service