Skip to Content
Merck
All Photos(1)

Key Documents

EMU039131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plk1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTACAGCAGCTGACCAGTGTCAACGCCTCCAAGCCCTCGGAGCGCGGGCTGGTGCGGCAAGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTATGGCCTTGGGTATCAGCTGTGTGACAACAGTGTGGGGGTGCTTTTTAATGACTCAACACGCCTGATTCTCTACAATGACGGGGACAGCCTGCAGTACATAGAGCGTGATGGCACGGAGTCCTATCTCACTGTGAGCTCCCATCCCAATTCCTTGATGAAGAAGATCACTCTCCTCAACTATTTCCGCAATTACATGAGTGAGCACCTGCTGAAGGCAGGACGCAACATCACACCCCGGGAAGGCGACGAGCTGGCCCGGCTGCCCTACCTACGAACGTGGTTCCGCACACGCAGCGCCATCATCCTGCACCTCAGCAACGGCACCGTGCAGATTAACTTCTTCCAGGACCACACCAAACTTATCCTGTGCCCCCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Riet van der Meer et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3211-3221 (2014-04-29)
To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated
Valentina Zuco et al.
Oncotarget, 6(11), 8736-8749 (2015-04-01)
Intrinsic and acquired tumor drug resistance limits the therapeutic efficacy of camptothecins (CPTs). Downregulation of the mitotic kinase PLK1 was found associated with apoptosis induced by SN38 (CPT11 active metabolite). We investigated the role of PLK1 in the cell response
Sixin Jiang et al.
Respiratory research, 16, 93-93 (2015-08-06)
Polo-like kinase 1 (Plk1) is a serine/threonine protein kinase that has been implicated in the regulation of mitosis. In addition, the activation of mitogen-activated protein kinase (MAPK) is a key event in the early stage of the growth factor response.
Hui Tian et al.
Molecular cancer research : MCR, 13(4), 784-794 (2015-01-13)
Protein S-palmitoylation is a widespread and dynamic posttranslational modification that regulates protein-membrane interactions, protein-protein interactions, and protein stability. A large family of palmitoyl acyl transferases, termed the DHHC family due to the presence of a common catalytic motif, catalyzes S-palmitoylation;

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service