Skip to Content
Merck
All Photos(1)

Documents

EMU032471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chek2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACAAGCGCCTGAAAGAAGCCACCTGTAAGCTCTACTTCTACCAGATGCTTGTAGCTGTACAGTACCTTCACGAAAATGGGATCATACATCGGGACTTAAAGCCGGAGAATGTTCTTTTATCATCTCAGGAAGAGGATTGTCTAATCAAGATCACTGACTTTGGGCAGTCCAAGATCTTGGGGGAGACCTCCTTGATGAGAACCTTATGTGGTACGCCCACTTATCTGGCTCCTGAGGTTCTTGTCTCCAACGGGACTGCTGGGTACAGCCGCGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTCATCTGCCTAAGTGGGTATCCACCTTTCTCTGAGCATAAGACCCAAGTGTCCCTGAAGGATCAGATCACCAGTGGAAAGTACAACTTTATTCCTGAAGTCTGGACAGATGTCTCAGAGGAGGCTCTGGACCTTGTCAAGAAACTGTTAGTTGTAGACCCAAAGGCTCG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
Chao-Ying Huang et al.
PloS one, 9(8), e104732-e104732 (2014-08-12)
In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service