Skip to Content
Merck
All Photos(1)

Key Documents

EMU015451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hif1a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCCTAACAGTCCCAGTGAATATTGCTTTGATGTGGATAGCGATATGGTCAATGTATTCAAGTTGGAACTGGTGGAAAAACTGTTTGCTGAAGACACAGAGGCAAAGAATCCATTTTCAACTCAGGACACTGATTTAGATTTGGAGATGCTGGCTCCCTATATCCCAATGGATGATGATTTCCAGTTACGTTCCTTTGATCAGTTGTCACCATTAGAGAGCAATTCTCCAAGCCCTCCAAGTATGAGCACAGTTACTGGGTTCCAGCAGACCCAGTTACAGAAACCTACCATCACTGCCACTGCCACCACAACTGCCACCACTGATGAATCAAAAACAGAGACGAAGGACAATAAAGAAGATATTAAAATACTGATTGCATCTCCATCTTCTACCCAAGTACCTCAAGAAACGACCACTGCTAAGGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Naoki Adachi et al.
Biochemical and biophysical research communications, 463(4), 1176-1183 (2015-06-19)
Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression
Alessia Brossa et al.
Oncotarget, 6(13), 11295-11309 (2015-05-08)
Different mechanisms of angiogenesis and vasculogenesis are involved in the development of the tumor vasculature. Among them, cancer stem cells are known to contribute to tumor vasculogenesis through their direct endothelial differentiation. Here, we investigated the effect of anti-angiogenic therapy
Bejan J Saeedi et al.
Molecular biology of the cell, 26(12), 2252-2262 (2015-04-24)
Intestinal epithelial cells (IECs) are exposed to profound fluctuations in oxygen tension and have evolved adaptive transcriptional responses to a low-oxygen environment. These adaptations are mediated primarily through the hypoxia-inducible factor (HIF) complex. Given the central role of the IEC

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service