Skip to Content
Merck
All Photos(1)

Key Documents

EHU157231

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTTCATGGACGGCTACACAGGAGAGTTTGACACCTTCCTCTACCAGCTGCCAGGAACAGTCCAGCCATGCTCCTCAGCCTCCTCCTCGGCCTCCTCCACATCCTCGTCCTCAGCCACCTCCCCTGCCTCTGCCTCCTTCAAGTTCGAGGACTTCCAGGTGTACGGCTGCTACCCCGGCCCCCTGAGCGGCCCAGTGGATGAGGCCCTGTCCTCCAGTGGCTCTGACTACTATGGCAGCCCCTGCTCGGCCCCGTCGCCCTCCACGCCCAGCTTCCAGCCGCCCCAGCTCTCTCCCTGGGATGGCTCCTTCGGCCACTTCTCGCCCAGCCAGACTTACGAAGGCCTGCGGGCATGGACAGAGCAGCTGCCCAAAGCCTCTGGGCCCCCACAGCCTCCAGCCTTCTTTTCCTTCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bin Huang et al.
Scientific reports, 8(1), 13895-13895 (2018-09-19)
Nur77 is a member of the NR4A subfamily of nuclear receptors and has been shown to regulate various biological processes such as apoptosis and inflammation. Here, we show that Nur77 ubiquitination is mediated by the tripartite motif 13 (Trim13), a
Zeyu Shi et al.
Theranostics, 11(7), 3376-3391 (2021-02-05)
Background: Colorectal cancer (CRC) and the associated metastatic lesions are reported to be hypoxic. Hypoxia is a common feature in the tumor microenvironment and a potent stimulant of CRC. We have identified a regulatory role of Nur77 on Akt activation
Meihui Huang et al.
Journal of Cancer, 10(15), 3560-3570 (2019-07-12)
NR4A1 acts as an oncogene and plays an important role in colorectal cancer development and progression, but little is known about the regulatory mechanism of NR4A1 expression. MicroRNA (miRNA) is involved in the progression of various tumors, affecting proliferation, apoptosis
Hiroki Maruoka et al.
Scientific reports, 10(1), 6325-6325 (2020-04-15)
Forskolin promotes neuronal differentiation of PC12 cells via the PKA-CREB-dependent signaling pathway. Activation of PKA by forskolin phosphorylates CREB, which then binds to CRE sites in numerous gene promoters. However, it is unclear which gene contains the CRE sites responsible
Xina Xie et al.
Clinical science (London, England : 1979), 129(12), 1151-1161 (2015-09-24)
Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service