Skip to Content
Merck
All Photos(1)

Key Documents

EHU119261

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGAGGTCAGTAGTTTAAAAGTTCTTAGTTATATAGCATCTGGAAGATCATTTTGAAATTGTTCCTTGGAGAAATGAAAACAGTGTGTAAACAAAATGAAGCTGCCCTAATAAAAAGGAGTATACAAACATTTAAGCTGTGGTCAAGGCTACAGATGTGCTGACAAGGCACTTCATGTAAAGTGTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCT

Ensembl | human accession no.

ENSG00000125384

NCBI accession no.

NM_000956

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTGER2(5732) , PTGER2(5732)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fusako Sakai-Takemura et al.
Communications biology, 3(1), 182-182 (2020-04-22)
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release
Qian Zhang et al.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, 34(4), 606-617 (2018-07-10)
Secondary hyperparathyroidism (SHPT) in patients with end-stage renal disease (ESRD) is characterized by hyperplasia of the parathyroid glands (PTGs), while the underlying mechanism is not completely understood. Previously we demonstrated a relationship between cyclooxygenase 2 (COX2) overexpression and parathyroid hyperplasia
Jigisha A Patel et al.
International journal of molecular sciences, 19(8) (2018-08-15)
Prostacyclins are extensively used to treat pulmonary arterial hypertension (PAH), a life-threatening disease involving the progressive thickening of small pulmonary arteries. Although these agents are considered to act therapeutically via the prostanoid IP receptor, treprostinil is the only prostacyclin mimetic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service