Skip to Content
Merck
All Photos(1)

Documents

EHU025841

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Yutao Yang et al.
Molecular neurobiology, 53(2), 1266-1278 (2015-04-16)
POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health.
He Huang et al.
Cell research, 28(1), 111-125 (2017-12-02)
Short-chain fatty acids and their corresponding acyl-CoAs sit at the crossroads of metabolic pathways and play important roles in diverse cellular processes. They are also precursors for protein post-translational lysine acylation modifications. A noteworthy example is the newly identified lysine
Sin Y Choi et al.
Journal of cellular and molecular medicine, 20(12), 2289-2298 (2016-07-16)
Epithelial-mesenchymal transition (EMT) and renal fibrosis are closely involved in chronic kidney disease. Inhibition of histone deacetylase (HDAC) has an anti-fibrotic effect in various diseases. However, the pathophysiological role of isoform-specific HDACs or class-selective HDACs in renal fibrosis remains unknown.
Xiaohua Yan et al.
Journal of molecular cell biology, 10(1), 48-59 (2017-10-17)
Evading TGF-β-mediated growth inhibition is often associated with tumorigenesis in liver, including hepatocellular carcinoma (HCC). To better understand the functions and the underlying molecular mechanisms of TGF-β in HCC initiation and progression, we carried out transcriptome sequencing (RNA-Seq) to identify

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service